Skip to main content

Table 2 Sequence information of the interference shRNAs

From: Host Prdx6 contributing to the intracellular survival of Brucella suis S2 strain

Names of shRNAs Sequences (5′–3′) Corresponding shRNA interference vectors
Prdx6-Mus-242 GAACTTGGCAGAGCTGCAAAG pGPH1/GFP/Neo-Prdx6-Mus-242
Prdx6-Mus-295 GTTGATTGCTCTTTCAATAGA pGPH1/GFP/Neo-Prdx6-Mus-295
Prdx6-Mus-460 GGACGCTAACAACATGCCTGT pGPH1/GFP/Neo-Prdx6-Mus-460
Prdx6-Mus-555 GCAGGAACTTTGATGAGATTC pGPH1/GFP/Neo-Prdx6-Mus-555