Skip to main content

Table 2 Gene targets and q-PCR primers used in this study with their derived proteins and functional classification. References include previous studies in which the target gene was investigated, chlamydial species studied and the model of persistence: PenG: penicillin; ID: iron depletion; IFN-γ, HS: Heat shock

From: Effect of female sex hormones on the developmental cycle of Chlamydia abortus compared to a penicillin-induced model of persistent infection

GenePrimer sequence (5′-3′)ProteinFunctional classificationReference
16S rRNAFw: CTTGTACACACCGCCCGTC
Rv: GCCCAACCTAGTCAAACCGTC
Ribosomal RNAReference gene 
GroELFw: CAACAGGTAGCAGAATCCGGA
Rv: CTCTTCGCTGATCAATTGGCCA
Heat shock protein 60Stress responseKalmar et al., 2015 [42]
C. abortus and C. psittaci
dnaKFw: ACCAACCGTTCATCACTATGGA
Rv: TGGCATGGAGCTTTTGTACG
Heat shock protein 70Mukhopadhyay et al., 2006 [43] C. pneumoniae. ID, IFN-γ, HS.
htrAFw: CAAGATGACGGTGTCTCTGCTTT
Rv: TGCTTCGACAGAAACAATCAGCA
ProteaseTimms et al., 2009 [17]
C. pneumoniae. IFN-γ, ID
grpEFw: CAACAGTTCCTACCCCCGATAA
Rv: CCTCATCTGACATCTGTGAGGC
Cofactor Hsp70Goellner et al., 2006 [15]
C. psittaci. PenG, ID, IFN-γ
ompAFw: GCATTATTGTTTGCCGCTAC
Rv: ATCACCTGAAGCACCTTCCCA
MOMPMembrane proteinsTimms et al., 2009 [17]
C. pneumoniae.
IFN-γ, ID
omcAFw: TGCCGTATTGTAGATTGCTGCT
Rv: TGAACTCCTGAATTGCACTCAG
outer mb protein AGoellner et al., 2006 [15]
C. psittaci. PenG, ID, IFN-γ
omcBFw: GTCGTATTCGATGCTCTGCCTA
Rv: AGCAACGGGTACCGTTAAAGT
outer mb complex protein BAmirshahi et al., 2011 [22]
C. trachomatis. Estradiol and progesterone
pmp17GFw: GGGTGATTGGGGTAACGATTGT
Rv: AGGTTGGTGAGATTGCTGCT
Polymorphic mb proteinWheelhouse et al., 2009 [36]
C. abortus
ftsWFw: TTGTTCCCTGCGTCGCTATC
Rv: AAAAGCTATTACGGCTGCGGA
cell division mb proteinCell divisionKalmar et al., 2015 [42]
C. abortus and C. psittaci
hctAFw: ACGTGACTTAGACAAGGCCGA
Rv: TGCTTTACGCTTAGATGCTGATT
DNA-binding histone-like proteinRegulation of RB-to-EB conversionGoellner et al., 2006 [15]
C. psittaci. PenG, ID, IFN-γ
euoFw: AAGGCTTCTAAAACAACCCGG
Rv: GGCTAATAACCCAAGCAGCG
DNA binding proteinGoellner et al., 2006 [15]
C. psittaci. PenG, ID, IFN-γ
CpafFw: CGCACCCTGAGCATCGTTA
Rv: AAGACAAAACCCCCAGCTCCT
chlamydial protease-like activity factorDegradation of proteinsKalmar et al., 2015 [42]
C. abortus and C. psittaci
sctNFw: TTCGATACCCTCATGTCGCAA
Rv: TACCTCCCCAACGCGTACATT
type III secretion cytoplasmic ATPaseType III secretion systemGoellner et al., 2006 [15]
C. psittaci. PenG, ID, IFN-γ
cydAFw: GGCGTTTGCATCCAAGAGTTA
Rv: GGTAGTGAAGGCGTTTTTGCTTT
cytochrome d ubiquinol oxidase sub IElectron transport systemAmirshahi et al., 2011 [22]
C. trachomatis. Estradiol and progesterone
cydBFw: TCCACACAACAACGTGTAGG
Rv: TAGTAAGACCGAGTCAGCAAAATGG
cytochrome d ubiquinol oxidase sub IIAmirshahi et al., 2011 [22]
C. trachomatis. Estradiol and progesterone
miaAFw: CGCCCACAAGAATAGGGACTT
Rv: GACAGCGCATTCCTCATTATCTGA
isopentenylpyrophosphate transferaseControl at the translational levelAmirshahi et al., 2011 [22]
C. trachomatis. Estradiol and progesterone