Skip to main content

Table 1 Primer sequences used for real-time quantitative PCR

From: Bacterial endotoxin decreased histone H3 acetylation of bovine mammary epithelial cells and the adverse effect was suppressed by sodium butyrate

GenePrimerProduct size (bp)GenBank accession No.
CSN1S1F: CTTTTCAGACAATTCTACCAGCT
R: AATTCACTTGACTCCTCACCAC
171NM_181029.2
CSN2F: AGTCCAAAGTCCTGCCTGTTCC
R: TGCCATATTTCCAGTCGCAGTC
193XM_015471671.2
CSN3F: CAATACGCTGTGAGAAAGATGA
R: AACTGGTTTCTGTTGGTAGTAA
122NM_174294.2
STAT5AF: CATGTCCCTCAAGAGGATCA
R: TCATTGCTGCCAACACTG
108NM_001012673.1
ACACAF: GATCCAGGCCATGCTAAG
R: CTGTTTCTCCAGCCACTC
103XM_024979607.1
FASNF: AGGACCTCGTGAAGGCTGTGA
R: CCAAGGTCTGAAAGCGAGCTG
85XM_005220997.3
S6K1F: GGACATGGCAGGGGTGTTT
R: GGTATTTGCTCCTGTTACTTTTCG
283NM_205816.1
ACSL1F: GCCGCATTTCACTTTTACTGC
R: AGCTCTTTAGGGCAAACCCC
136NM_001076085.1
ACSS2F: GGGCGAATGCCTCTACTGC
R: GCTGGGTGATGATGGATGG
254NM_001105339.1
GAPDHF: GGGTCATCATCTCTGCACCT
R: GGTCATAAGTCCCTCCACGA
177NM_001034034.2
  1. CSN1S1: casein alpha s1; CSN2: casein beta; CSN3: casein kappa; STAT5A: signal transducer and activator of transcription 5A; ACACA: acetyl-CoA carboxylase 1; FASN: fatty acid synthase; S6K1: ribosomal protein S6 kinase 1; ACSL1: acyl-CoA synthetase long-chain family member 1; ACSS2: acyl-CoA synthetase short-chain family member 2; GAPDH: glyceraldehyde-3-phosphate dehydrogenase