Skip to main content

Table 1 Primers used in this study

From: Truncated Rep protein of porcine circovirus 2 (PCV2) caused by a naturally occurring mutation reduced virus replication in PK15 cells

Primer Sequence (5′-3′) Size
ZY009 CCATATGAAATAAATTACTGAG 785 bp
ZY010 CAGCGCACTTCTTTCGTTTTCAG
ZY001 CGGGGTACCACTGAGTCTTTTTTATCACTTCG 1777 bp
ZY002 CCCAAGCTTAAGACTCAGTAATTTATTTCATATGG
HY008 CGGGGTACCTCCTTGGATACGTCATATCTGAAAACG 1077 bp
HY009 CCATTACGAAGTGATAAAAAAGACTCAGTAATTTATTTCATATGG
HY010 GAAATAAATTACTGAGTCTTTTTTATCACTTCGTAATGG 862 bp
HY011 CCCAAGCTTTCTTTTTGCTGGGCATGTTGCTGC
HY012 CGGGGTACCTCCTTGGATACGTCATCGCTGAAAACG 1077 bp
HY013 CCCAAGCTTTCTTCTTGCTGGGCATGTTGCTGC
ZY097 GGGTTATGGTATGGCGGGAG 192 bp
ZY098 CCCTCACTGTGCCCTTTGAA
  1. Note: The underlined sequences represent restriction enzyme sites introduced