Skip to main content

Table 2 Primers for RT-PCR

From: Comparative proteomic analysis reveals drug resistance of Staphylococcus xylosus ATCC700404 under tylosin stress

Gene name Primer Squences Size(bp) Annealing temp(°C)
rplW F:5-TGGAAGCAAGAGACGTTCTTAAGCG-3
R:5-TAGCACGAGTATCAACGTCGAATGTG-3
99 60
infB F:5-AGCAGGTGGTATTACACAGCATATCG-3
R:5-GCGTGGCCTGGCGTATCAAG-3
87 60
trxA F:5-CAACTTGGTGTGGCCCTTGT-3
R:5-ACAACTTTATCTACTGGTTCGCCA-3
187 60
aldA-1 F:5-GTGACCGCAGGCATCGTTCC-3
R:5-CTGCTGGTATTGTTGACTCACGAATG-3
166 60
katA F:5-GAGAGGTGATTCCAGAACGACGTATG-3
R:5-ATCCACGAATATCACGCTCTGCATC-3
198 60
gros F: AGAGCAAACAACAAAGAGCGG
R: GCCCTGCACCTACTGCAATTA
89 60
16sRNA F: CGGGCAATTTGTTTAGCA
R: ATTAGGTGGAGCAGGTCA
112 60