Skip to main content

Table 3 Primers used for amplification of E. coli and enterotoxins in digesta samples

From: Protective effect of chicken egg yolk immunoglobulins (IgY) against enterotoxigenic Escherichia coli K88 adhesion in weaned piglets

Target gene Orientation Sequence (5′-3′) Tm (°C) Product size (bp)
Total bacteria Forward CGGTCCAGACTCCTACGGG 63 200
Reverse TTACCGCGGCTGCTGGCAC   
Escherichia coli Forward CCGATACGCTGCCAATCAGT 65 884
Reverse ACGCAGACCGTAGGCCAGAT   
K88 fimbriae Forward GCACATGCCTGGATGACTGGT 63 439
Reverse CGTCCGCAGAAGTAACCCCACCT   
Heat-stable enterotoxin b Forward TGCCTATGCATCTACACAAT 63 110
Reverse CTCCAGCAGTACCATCTCTA   
Heat-stable enterotoxin a Forward ATGAAAAAGCTAATGTTGGC 65 193
Reverse TACAACAAAGTTCACAGCAG   
Heat-labile enterotoxin Forward CCGTGCTGACTCTAGACCCCCA 68 480
Reverse CCTGCTAATCTGTAACCATCCTCTGC