Skip to main content

Table 3 Primers used for Real-time PCR

From: Prostaglandin F (PGF) production possibility and its receptors expression in the early- and late-cleaved preimplantation bovine embryos

Gene symbol GenBank accession No. Primer sequence 5′ to 3′ Amplicon size
(bp)
GAPDH NM_001034034.2 CACCCTCAAGATTGTCAGCA
GGTCATAAGTCCCTCCACGA
103
PGFS S54973.1 GGAGGACCCCAGGATCAAAG
CTCAGCAATGCGTTCAGGTG
130
PGFR D17395 TCAGCCCTCACCCAGATAGT
GGCCATTTCACTGTTCAGG
247