Skip to main content

Table 1 Primers for relative-quantitative real time RT-PCR analyses

From: Thermal manipulation of the broilers embryos: expression of muscle markers genes and weights of body and internal organs during embryonic and post-hatch days

Gene Sequence
cGAPDH F-5’GTGTTATCATCTCAGCTCCCTCAG’3
cGAPDH R-5’GGTCATAAGACCCTCCA CAATG3’
cIGF-1 F-5’GTGTTTGCTTACCTTAACCAGTT ‘3
cIGF-1 R-5’GTACAGAGC GTGCAGATT’3
cGH F-5’ GACCAGAGGTACACCAACAAA3’
cGH R-5’GACTGGATGAGAACCAGTGAAA3’
cMyoD F-5’TACCCAGTGCTGGAGCACTA’3
cMyoD R5’GTCTTGGA GCTTGGCTGAACT’3
cMyogenin F-5’AGCAGCCTCAACCAGCAGGA’3
cMyogenin R-5’TCT GCCTGGTCATCGCTCAG’3
cPAX7 F-5’ACTGTGCCCTCAGTGAGTTCGATT’3
cPAX7 R-5’ATTCGACATCGGAGCCTTCATCCA ‘3
cPCNA F-5’ACGCATTTGTAGAGACC TCAGCCA
cPCNA R-5’AGTCAGCTGGACTGGCTCATTCAT’3
  1. GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IGF-1, insulin-like growth factor 1; GH, growth hormone; MyoD, myogenic differentiation gene; Pax7, paired box transcription factor; PCNA, proliferating cell nuclear antigen