Skip to main content

Table 5 RPA primers and LF-probe designed in this study

From: Use of a recombinase polymerase amplification commercial kit for rapid visual detection of Pasteurella multocida

Name Sequence(5′-3′) Genome location Amplification size(bp)
Kmt1-F1 CGATTGCCGCGAAATTGAGTTTTATGCCAC 249–278 192
Kmt1-F2 TTGCCGCGAAATTGAGTTTTATGCCACTTG 252–281 189
Kmt1-F3 ATTGAGTTTTATGCCACTTGAAATGGGAA 262–290 179
Kmt1-R Biotin-AATAACGTCCAATCAGTTGCGCCGTTGTCA 411–440  
Kmt1-LF Probe FITC-ATGGCATTATTTTATGGCTCGTTGTGAGTG
[dSpacer]GCTTGTCGGTAGTCTT-C3 Spacers
291–337 150
Pm-F1 CGATTGCCGCGAAATTGAGT 249–268 241
Pm-F2 CAGAGTTTGGTGTGTTGA 378–395 113
Pm-R CAGACTGACAAGGAAATATAAAC 468–490  
  1. Abbreviations: dSpacer is an exonuclease site, and C3 Spacers is a polymerase extension blocking site