Skip to main content

Table 1 Sequence information of the primers used for QPCR

From: Uric acid transporters BCRP and MRP4 involved in chickens uric acid excretion

Gene Primer Sequence (5′–3′) Length Accession No.
BCRP-F CAGCAAGCAAGGAAGATCAC 129 bp NM_001328490.1
BCRP-R GGCTGGAGTTGAGATACTTC
MRP4-F TAGTGTTGGTCAGAGACAGC 167 bp NM_001030819.1
MRP4-R GTGCAATGGTCAGAACTGTG
18S rRNA-F CGGCGACGACCCATTCGAAC 99 bp M_59389.1
18S rRNA-R GAATCGAACCCTGATTCCCCGTC