Skip to main content

Table 1 Primer sequences for common porcine gastrointestinal pathogens

From: Rapid and visual detection of Lawsonia intracellularis with an improved recombinase polymerase amplification assay combined with a lateral flow dipstick

Pathogens primers(5′-3′) product length
(base pair)
GenBank accession no.
L. intracellularis F:AAATCCAAAAGTCGAGTATCTAACTGCGG 292 AM180252
R:TAAAAACCCAGAGCAAAATCGTGATACCAGGCG  
E. coli F:AACGGTTGCTCTTCATTTAG 678 CP034794
R:GACCATCCAATAAGTGTG  
S. Cholerasuis F:GCTCTTTCGTCTGGCATTA 351 CP034819
R:AACTTCATCGCACCGTCA  
E. faecalis F:AAAGTAGAATTAGATCCACAC 320 CP031027
R:TCTATCACATTCGGTTGCG  
B. hyodysenteriae F:ACTAAAGATCCTGATGTATTTG 352 CP019600
R:CTAATAAACGTCTGCTGC  
PCV2 F:GGTGCCCGCTGCCACATCGAGAAAG 589 MH718995
R:AGCTTCTACAGCTGGGACAGCAG  
PRV F:GAGTACGTCACGGTCATCAAGGAG 553 NC006151
R:CACTTCCGGTTTCTCCGGATC  
PoRV F:GGCTTTAAAAGAGAGAATTTCCG 1062 JF835112
R:GGTCACATCATACAATTCTAA  
PEDV F:CATGGGCTAGCTTTCAGGTC 182 MK288006
R:CGGCCCATCACAGAAGTAGT  
TGEV F:TCTTTCTTCTACCCTATTATGACTG 1117 KT696544
R:CTYTGGAGTATGGTGGTGTTC  
CSFV F:GGTGGTCTAAGTCCTGAGTACAGG 177 MK121886
R:GCCTCTGCAGCACCCTATCAGGTCG