Skip to main content

Table 4 The primers used for PCR amplification of Y chromosome-specific probe

From: A dual colour FISH method for routine validation of sexed Bos taurus semen

  Size of PCR product Type of primer Sequence of primer 5′ - > 3’
btDYZ1 243 bp Forward TGTAGATGTGTGTGCCATCC
Reverse ACCGGTTCCACAGTCTCTAG