Skip to main content

Table 3 The primers used for PCR amplifications of X chromosome-specific probes

From: A dual colour FISH method for routine validation of sexed Bos taurus semen

  Size of PCR product Type of primer Sequence of primer 5′ - > 3’
X1 234 bp Forward CTGCTGTGGCTTCCTGGTTA
Reverse GTATCATGGCCTCCCTCAGC
X2 532 bp Forward GTCAACGGAGGTACAGAGGC
Reverse AGCAGACCTCTGGAGACACA
X3 555 bp Forward TGGCCAACCAGGAAAAGACT
Reverse TGGGACTGCTAATTGTGGGT
X4 203 bp Forward CATGAGAAGAAACACCATGCCC
Reverse CCACACCCTTCAATCTTGGTCAG
X5 275 bp Forward GTCAGTCCTGCAACAGGGAA
Reverse TCTGGCACTTTAAATACTGAGAGAC
\