Skip to main content

Table 1 Primers information for qRT-PCR in the study

From: All-trans retinoic acid inhibits lipopolysaccharide-induced inflammatory responses in bovine adipocytes via TGFβ1/Smad3 signaling pathway

Gene Primer sequences(5′-3′) Size(bp)
ADPN F GGAATGACAGGAGCTGAAGG
R CGAATGGGTACATTGGGAAC
143
C/EBPα F TGGACAAGAACAGCAACGAG
R TCACTGGTCAACTCCAGCAC
127
IL-6 F GCAAGGAGACACTGGCAGAA
R CTCCAGAAGACCAGCAGTGG
122
IL-10 F TGAAGGACCAACTGCACAGC
R TGTGGCATCACCTCTTCCAG
121
IL-17 F TGAGTCTGGTGGCTCTTGTG
R GGAGAGTCCAAGGTGAGGTG
180
PLIN1 F CACCTGTGAGTGCTTCCAGA
R AGCTACGAACTGGGTGGACA
163
PPARγ F CGAGAAGGAGAAGCTGTTGG
R TCAGCGGGAAGGACTTTATG
122
TNF-α F TCTTCTGCCTGCTGCACTTC
R CGGCTTGTTACTTGAGGCTTG
128
TGFBR1 F ATGGTTCCGTGAAGCAGAGA
R CTGACACCAACCAGAGCTGA
119
TGFBR2 F AAGCAGAACACGTCTGAGCA
R CAGGATGTTCTCGTGCTTGA
126
Smad3 F AGCTGACACGGAGGCATATC
R GCCATAGCGCTGGTTACAGT
125
TGF-β1 F GAACTGCTGTGTTCGTCAGC
R TCCAGGCTCCAGATGTAAGG
126
GAPDH F AAGTTCAACGGCACAGTCAA
R TACTCAGCACCAGCATCACC
121