Skip to main content

Table 2 Primers used for quantification of Trβ, Oc and Mgp mRNA levels in S. senegalensis

From: The organophosphate pesticide -OP- malathion inducing thyroidal disruptions and failures in the metamorphosis of the Senegalese sole, Solea senegalensis

Gene target Primers Sequence (5′-3′) Base origin Size (bp)
Sse UB SseUB1 AGCTGGCCCAGAAATATAACTGCGACA 256 93
(AB291588.1) SseUB2 ACTTCTTCTTGCGGCAGTTGACAGCAC 348
SseTrβ SseTrβF3 AAACAGAAGCGGAAGTTCCTGAGTGCAG 493 100
(GU946412) SseTrβF4 CTTTGTTTCCTTCAGGTGTGTTTGCCATC 592
Sse MGP SseMGP1 GGTGCCCGGAGTCAGCCACA 88 113
(AY113679) SseMGP2 AGCTGGTCTCTGGGGTCTCAGGTT 200
Sse OC SseOC1 GGTTCTCTGCTCCCTGGCCGTCCTCT 21 115
(AY823525) SseOC2 GACGCCTGCTCCTGCTCCACAAACAA 135