Skip to main content

Table 2 Primer details [47]

From: Stimulation of bovine monocyte-derived macrophages with lipopolysaccharide, interferon-ɣ, Interleukin-4 or Interleukin-13 does not induce detectable changes in nitric oxide or arginase activity

Gene Forward Sequence Reverse Sequence No. bp Efficiency
nos2 TTGAGATCAACGTCGCTGTG CATGATGGTCACGTTCTGCT 56 98
arg1 ATGTGGACCCTGGGGAAC ATGTTTCTTCCATCACCTTGC 105 101
gapdh CACCATCTTCCAGGAGCGAG CCAGCATCACCCCACTTGAT 51 100