Skip to main content

Table 4 PCR primer pairs used to amplify the feline CYP2R1 and CYP27B1 genes

From: A genetic variant of CYP2R1 identified in a cat with type 1B vitamin D-dependent rickets: a case report

PCR Product Forward Primer (5′-3′) Reverse Primer (5′-3′)
CYP2R1
 exon 1 exon 1 GCACTGTAGACTCTGAGCGG TCACTTGCACAGAGGGTTGG
 exon 2 exon 2 AGAGCTGGACTTAGCACATG TGATTCAAGTGTGCATGCAC
 exon 3 former TGAGTAGCAGAGAACAGGGC GCATCAACGAAATGCTGAGGT
 exon 3 latter AGTGCCTCCGTCTTCCTGTA AGAAACTGGCGTTCAGGTCC
 exon 4 exon 4 CTGGTTGTCCCCATACCCTG CGTCCTGAAGTTATGCCCCA
 exon 5 exon 5 CACTGAGCTGAAGTGGGACA CATCCACGGCCCTTCTTACT
CYP27B1
 exon 1 exon 1 AGAGGGGGCGTCACCACTATCC CCGGCAGCCCCAATTTCTCTAT
 exon 2 exon 2 CTTGCACAGCCCAGCGAACACC GGAAGCCCCATTTACCAGAAGG
 exon 3 exon 3 CCGGGGCAGGAAATGAGTAAC CAGGCAGCCCAGGCGTGAACC
 exon 4 exon 4 GGGATGTGGCGGGAGAGTTTTA TGGGGAGAAGGTACAGGGATGC
 exon 5 exon 5 CCTGGAGGCCGAAGTGC CCAACAGGGAGGAGAACC
 exon 6 exon 6 GAGCCCAACTTCCAGAGC CCAGGCCTTCCCAGCATTTT
 exon 7 exon 7 AAGGCGGTGGTCAAGGAAGTG CAGGCCAAAGGGAGGGTGAA
 exon 8 TCCAAAAGTAGCCCCAGAA TATTTTGCTATGCTTGTCAGAA
 exon 9 TCGACCAACCTAACACTAATAA AGAAAGGATGAGCAGACACA