Skip to main content

Table 2 Primers for PCR or sequencing

From: A gD&gC-substituted pseudorabies virus vaccine strain provides complete clinical protection and is helpful to prevent virus shedding against challenge by a Chinese pseudorabies variant

Primer Sequence (5′- 3′)
Bartha-gC-H1-F CATGAATTCGCGTCGACGATGCTGCTCGG
Bartha-gC-H1-R TCAGGTACCGTTAATTAACAAAAACGACGCGAGCGTGGG
Bartha-gC-H2-F CGAGGATCCGTTAATTAACCACGTCGAATCAATAAACG
Bartha-gC-H2-R CACAAGCTTCCGTGAACAACATGCTGCTG
AH02LA-gD-F TCGATCTACATCTGCGTCGC
AH02LA-gD-R ATCATCGACGCCGGTACTGC
Kan ins gD F TCCGTCGACGGCGTGAACATCCTCACCGACTTCATGGTGGCGCTCCCCGGGATGACGACGATAAGTAGGGATAAC
Kan ins gD R TACGTCGACGGGTAATGCCAGTGTTACAACCA
Bartha ins gDA-kan F CATGCTGCTCGCAGCGCTAT
Bartha ins gDA-kan R GCCGGTACTGCGGAGGCTAC
AH02LA gC flanking F GCGTCGACGATGCTGCTCGG
AH02LA gC flanking R CCGTGAACAACATGCTGCTG
SEQ-AH02LA gC F ACTTTTTCACGACGCCGCGG
SEQ-AH02LA gC R AAGCGGACCTCGAAGGTCTC