Skip to main content

Table 1 Primers and probe

From: Development and evaluation of a broadly reactive reverse transcription recombinase polymerase amplification assay for rapid detection of murine norovirus

Name Sequence Amplicon length
MNV-F ATGCATGGTGAAAAGTACTAT 788 bp
MNV-R TAGAAAGAAGGCGACCAGAGA
f1 CAGTCTTTGTGAATGAGGATGAGTGATG 189 bp
r1 AAAATTTTGGAAGATCCAGGGGTCAATTT
f2 CAAATCAACCAAATTGACCCCTGGATCTT 151 bp
r2 ACCTCCATGTTCCCAACCCAGCCGGTGTACAT
f3 CAAAATTTTGTCCAGTGCCCCCTTGGTGAGTT 135 bp
r3 AGGACCAGCTGAACCTCCATGTTCCCAACCCA
f4 CACGCCACCGGTCTGTTCTGCGCTGGGTGC 154 bp
r4 AAGGAACAAGATCCTGGCCGCTGGCTTC
f5 TTCCAAAATTTTGTCCAGTGCCCCCTTGGT 131 bp
r5 GCTGAACCTCCATGTTCCCAACCCAGCCGGTG
f6 TTCAGCTGGTCCTCGCCGGCAATGCCTTTA 141 bp
r6 CCAGGGTGCGCACATCACACATGACATGTG
probe TCGAAACACCCCAGGCGAAATATTGTTTGA(BHQ)(THF)(FAM)GGCCCTCGGGCCAGG
  1. BHQ1-dT dT-fluorophore, THF tetrahydrofuran, FAM-dT dT-quencher group