Skip to main content

Table 3 The primer sequences of target and internal reference genes used in qRT-PCR

From: Replacement of grains with soybean hulls ameliorates SARA-induced impairment of the colonic epithelium barrier function of goats

Gene Forward primer Reverse primer PCR products (bp)
Erk1 CTCAGCTTACGACCATGTGC TCAGGTCCTGCACGATGTAG 203
Erk2 CTCAGCAACGACCACATCTG CCAGGCCAAAGTCACAGATC 151
p38 ACAACATCGTCAAGTGCCAG CACGTAGCCAGTCATCTCCT 209
JNK TCAGTCAGTTGAGCACCAGT ACTTATGCCTGCTCTGCTCA 229
Claudin-1 CACCCTTGGCATGAAGTGTA AGCCAATGAAGAGAGCCTGA 216
Claudin-4 AAGGTGTACGACTCGCTGCT GACGTTGTTAGCCGTCCAG 238
Occludin GTTCGACCAATGCTCTCTCAG CAGCTCCCATTAAGGTTCCA 200
ZO-1 CGACCAGATCCTCAGGGTAA AATCACCCACATCGGATTCT 163
GAPDH GGGTCATCATCTCTGCACCT GGTCATAAGTCCCTCCACGA 180