Skip to main content

Advertisement

Table 3 Sequences of PCR primers used in this study

From: Prostaglandin E2 secreted from feline adipose tissue-derived mesenchymal stem cells alleviate DSS-induced colitis by increasing regulatory T cells in mice

Gene Forward (5′-3′) Reverse (5′-3′) Reference
fGAPDH ACGATGACATCAAGAAGGTG CACACCAGGAAATGAGCTTG [51]
fFOXP3 GCCTGCCACCTGGAATCAAC GTGTGCTGGGGCTTGGGA [52]
fIFN-γ TACACAAGTTTTATTTTCGCTTTCC TGCTACATCTGGATTACTTGCATTA [51]
fIL-6 TGAAAAAGGAGATGTGTGACAACTA CCTGAAGACCAGTAGTGATTCTTGT [51]
fIL-10 CCTTTAGTAAGCTCCAAGAGAAAGG CAGATTTTCATCTTCATTGTCATGT [51]
fTNF-α GACACTCAGATCATCTTCTCGAACT GACCTGGGAGTAGATGAGGTACAG [51]
fIL-1β CATACAGTCACAGGACTACACGTTC TTGATGCACAACACTACTGGTATCT This study
fIL-4 GGCAGATCTATACACATCACAACTG GCTTTGAGTATTTCTTTTGCATGAT This study
mGAPDH TCATTGACCTCAACTACAA ACACCAGTAGACTCCACGT [51]
mINF-γ CACAGTCATTGAAAGCCTAGAAAGT AGTTCCTCCAGATATCCAAGAAGAG This study
mIL-6 CGCACTAGGTTTGCCGAGTA CCTTTCTACCCCAATTTCCA This study
mIL-10 GTGATTTTAATAAGCTCCAAGACC GATCATCATGTATGCTTCTATGCAG This study
mTNF-α CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG [51]
mIL-1β GTCTTTCCCGTGGACCTTC TGTTCATCTCGGAGCCTGT [51]
mIL-4 TAGTTGTCATCCTGCTCTTCTTTCT CGATGATCTCTCTCAAGTGATTTTT This study
fCOX-2 CGATTCAGTCTCTCATCTGCAATAA TCAGTTGAACGTTCTTTTAGCAGTA [51]