Skip to main content

Table 1 Information about the real-time PCR primers used to measure mRNA transcript levels of various cytokines

From: In vitro immune responses of porcine alveolar macrophages reflect host immune responses against porcine reproductive and respiratory syndrome viruses

Genes Forward Primer (5′- 3′) Reverse Primer (5′- 3′) Accession/Reference
β-Actin GCGGGACATCAAGGAGAAG AGGAAGGAGGGCTGGAAGAG U07786
IFN-α TCTCATGCACCAGAGCCA CCTGGACCACAGAAGGGA [39]
IFN-β AGTGCATCCTCCAAATCGCT GCTCATGGAAAGAGCTGTGGT M86762
TNF-α TTATTCAGGAGGGCGAGGT AGCAAAAGGAGGCACAGAGG NM214022
IL-1α GTGCTCAAAACGAAGACGAACC CATATTGCCATGCTTTTCCCAGAA NM_214029.1
IL-1β AACGTGCAGTCTATGGAGT GAACACCACTTCTCTCTTCA M86725
IL-6 CCACCAGGAACGAAAGAGAG AGGCAGTAGCCATCACCAGA NM_214399
IL-8 TAGGACCAGAGCCAGGAAGA CAGGAAAACTGCCAAGAAGG M86923.1
IL-10 TGACGATGAAGATGAGGAAGAA GAACCTTGGAGCAGATTTTGA NM214041
IL-12 TCAGGGACATCATCAAACCA GAACACCAAACATCAGGGAAA NM214013
IFN-γ GACTTTGTGTTTTTCTGGCTCTTAC TTTTGTCACTCTCCTCTTTCCA NM213948
IL-2 TGCACTAACCCTTGCACTCA CCTGCTTGGGCATGTAAAAT X56750
IL-4 TTTGCTGCCCCAGAGAAC TCCTGTCAAGTCCGCTCA X68330
  1. IL interleukin, IFN interferon