Identification and characterization of Staphylococcus devriesei isolates from bovine intramammary infections in KwaZulu-Natal, South Africa

Table 3 Amplification of the 16S rRNA, dnaJ, hsp60 and rpoB genes of the coagulase-negative Staphylococcus isolates

Gene target	Primer name	Oligonucleotide sequence^a (5′ – 3′)	PCR amplification conditions	Size of amplicon (bp)	Reference
16S rRNA	16F27 16R1522	AGAGTTTGATCCTGGCTCAG AAGGAGGTGATCCAGCCGCA	95 °C for 5 min, 30 cycles of [95 °C for 30 s, 58 °C for 60 s, 72 °C for 90 s] and a final extension step at 72 °C for 10 min	1500	[8]
dnaJ	SA-(F) SA-(R)	GCCAAAAGAGACTATTATGA ATTGYTTACCYGTTTGTGTACC	94 °C for 3 min, 5 cycles of [94 °C for 30 s, 45 °C for 30 s, 72 °C for 60 s], 30 cycles of [94 °C for 30 s, 50 °C for 30 s, 72 °C for 60 s], 72 °C for 3 min	920	[21]
hsp60	hsp60-F hsp60-R	CAIIIGCIGGIGAYGGIACIACIAC YKIYKITCICCRAAICCIGGIGCYTT	94 °C for 2 min, [94 °C for 60 s, TD^b for 2 min, 72 °C for 5 min], 20 cycles of [94 °C for 60 s, 35 °C for 2 min, 72 °C for 5 min], 72 °C for 10 min	600	[36]
rpoB	1418f 3554r	CAATTCATGGACCAAGC CCGTCCCAAGTCATGAAAC	94 °C for 5 min; 30 cycles of [94 °C for 45 s, 52 °C for 60 s, 72 °C for 90 s]; 72 °C for 10 min	899	[16]

^aAll primers were synthesized by Inqaba Biotechnical Industries (South Africa)
^bTD = Touchdown PCR from 45 °C to 35 °C with temperature decrease of 0.5 °C per cycle; I Inosine, K Keto (G or T), Y pyrimidine (C or T)

ISSN: 1746-6148