Skip to main content

Table 3 Amplification of the 16S rRNA, dnaJ, hsp60 and rpoB genes of the coagulase-negative Staphylococcus isolates

From: Identification and characterization of Staphylococcus devriesei isolates from bovine intramammary infections in KwaZulu-Natal, South Africa

Gene target Primer name Oligonucleotide sequencea (5′ – 3′) PCR amplification conditions Size of amplicon (bp) Reference
16S rRNA 16F27
16R1522
AGAGTTTGATCCTGGCTCAG
AAGGAGGTGATCCAGCCGCA
95 °C for 5 min, 30 cycles of [95 °C for 30 s, 58 °C for 60 s, 72 °C for 90 s] and a final extension step at 72 °C for 10 min 1500 [8]
dnaJ SA-(F)
SA-(R)
GCCAAAAGAGACTATTATGA
ATTGYTTACCYGTTTGTGTACC
94 °C for 3 min, 5 cycles of [94 °C for 30 s, 45 °C for 30 s, 72 °C for 60 s], 30 cycles of [94 °C for 30 s, 50 °C for 30 s, 72 °C for 60 s], 72 °C for 3 min 920 [21]
hsp60 hsp60-F
hsp60-R
CAIIIGCIGGIGAYGGIACIACIAC
YKIYKITCICCRAAICCIGGIGCYTT
94 °C for 2 min, [94 °C for 60 s, TDb for 2 min, 72 °C for 5 min], 20 cycles of [94 °C for 60 s, 35 °C for 2 min, 72 °C for 5 min], 72 °C for 10 min 600 [36]
rpoB 1418f
3554r
CAATTCATGGACCAAGC
CCGTCCCAAGTCATGAAAC
94 °C for 5 min; 30 cycles of [94 °C for 45 s, 52 °C for 60 s, 72 °C for 90 s]; 72 °C for 10 min 899 [16]
  1. aAll primers were synthesized by Inqaba Biotechnical Industries (South Africa)
  2. bTD = Touchdown PCR from 45 °C to 35 °C with temperature decrease of 0.5 °C per cycle; I Inosine, K Keto (G or T), Y pyrimidine (C or T)