Skip to main content

Table 1 Sequence of primers used for RT-PCR and sequencing

From: Molecular detection of enteric viruses and the genetic characterization of porcine astroviruses and sapoviruses in domestic pigs from Slovakian farms

Virus Primer Sequence (5′-3′) Region Size (bp) References
PAstV panAV-F11 GARTTYGATTGGRCKCGKTAYGA RdRp 420–400 [36]
panAV-F12 GARTTYGATTGGRCKAGGTAYGA
panAV-F21 CGKTAYGATGGKACKATHCC
panAV-F22 AGGTAYGATGGKACKATHCC
panAV-R1 GGYTTKACCCACATICCRAA
PSaV PECVcapsidF CTCATCAACCCTTTTGAAAC Capsid protein 757 [26]
PECVcapsidR AAAGCATGATGTTGTTAGGC
TGEV T1 GTGGTTTTGGTYRTAAATGC Spike protein 858 [33]
T2 CACTAACCAACGTGGARCTA
PEDV P1 TTCTGAGTCACGAACAGCCA Spike protein 650
P2 CATATGCAGCCTGCTCTGAA