Skip to main content

Table 5 Candidates obtained with less than 100% of identity with the ASFV genome and their copy number (CN) grouped by isomiRs

From: African swine fever virus does not express viral microRNAs in experimentally infected pigs

Candidate ID Candidate sequences blast vs ASFV < 100% IsomiRs CN Candidates CN
ASFV-C9 TCTCCCAACCTGTACAGT 4 9
TCTCCCAACCTGTACAGGT 1
CTCCCAACCTGTACAGT 3
TCGTCCCAACCTGTACAGT 1
ASFV-C10 TGAGGTAGTAGGTTGTGT 2 4
TGAGGTAGTAGGTTGTGTG 2
ASFV-C11 CGCTGCGGGTGTGGTGGGCC 1 2
CGCTGCGGGTGTGGTGG 1
ASFV-C12 TGTGCAAATCTATGCAAAAC 2 2
ASFV-C13 GGTAGTAGGTTGTGTGGTT 1 2
GGTAGTAGGTTGTGTGGAT 1
ASFV-C14 AGGGCACCAAGGTAAC 1 1
ASFV-C15 ACGCCCTGGGGCCTATGAG 1 1
ASFV-C16 TCGCTGCGGGTGTGGTGGG 1 1
ASFV-C17 CCGCTGCGGGATGAAC 1 1
ASFV-C18 GGGAAAATCCACGGCCCTGC 1 1
ASFV-C19 TGTATGGAGGCCCTTTTT 1 1
ASFV-C20 CTCCTGGGGCCGCACTCTC 1 1
ASFV-C21 TTCACTGCCCTGATCCTCT 1 1
ASFV-C22 GCGACCCGTCAAGTCCAACAG 1 1
ASFV-C23 GTCGGAGCCTGAGCCGGGAG 1 1
ASFV-C24 CCCCCACACAGTTTGAC 1 1
ASFV-C25 TCTCCCAATCCTTGCCAGT 1 1