Skip to main content

Table 4 Candidates obtained with a 100% of identity with the ASFV genome and their copy number (CN)

From: African swine fever virus does not express viral microRNAs in experimentally infected pigs

Candidate ID Candidate sequences blast vs ASFV = 100% Candidates CN
ASFV-C1 GAGACCAAGAACCTGGGCA 2
ASFV-C2 ATGTGCCCTGGTCCCGTAGGAGTG 1
ASFV-C3 CGTCTGGGAGAAATGGAGCA 1
ASFV-C4 CACCGTGTGGATGCCCAGGG 1
ASFV-C5 GAGCTCGTGACCATTGAA 1
ASFV-C6 GGTTCACTGGTGTCCATGAT 1
ASFV-C7 ATGATCGTAGCATTTGGTGTA 1
ASFV-C8 GGCGAGTCACTTGGTTTGCT 1