Skip to main content

Table 2 Sequence variation in multiple sequences alignment

From: Specific detection of Muscovy duck parvovirus infection by TaqMan-based real-time PCR assay

Primers Sequence(5′ → 3′)b1 Frequency GenBank accession numbers MDPVsb2
MDPV-qF TACGAATGAACAAACCAA 80.0% (12/15) /
CACGAATGAACAAACCAA 13.33% (2/15) KU844281, JF926697
TACGAATGAACGAACCAA 6.67% (1/15) KC171936
MDPV-qR CGCTCTTAATATCTCCTCTA 93.33% (14/15) /
TAGAAGAGATATTAAGAGCG 6.67% (1/15) KT865605
MDPV-qP TGAACGAGCGAATGAGCCTTCC 100% (15/15) /
  1. b1The variations are marked as Bold and underline
  2. b2The GenBank accession numbers of MDPV strains used in this study are as follows: U22967, KU844282, KX000918, JF926698, KM093740, KY744743, KY069274, JF926695, KY511293, JF926696, X75093, KU844281, JF926697, KC171936, and KT865605. Only variations from GenBank accession numbers of MDPV strains have been marked