Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer sequences used for real-time PCR amplification of selected genes in the livers of lactating goats

From: Sodium butyrate improves antioxidant stability in sub-acute ruminal acidosis in dairy goats

Genea Primers 5′ to 3’b Size(bp) Accession c
SOD1 ACACAAGGCTGTACCAGTGC
TTCACATTGCCCAGGTCTCC
104 NM_001285550.1
SOD2 TCAATAAGGAGCAGGGACGC
AGCAGGGGGATAAGACCTGT
85 XM_005684984.1
SOD3 ATCGACCCGAACGGTAACGC
AGGACATAGAAGGGGTCTGCG
199 XM_005681678.1
CAT ACAATGTCACTCAGGTGCGG
TCTCACACAGGCGTTTCCTC
70 XM_005690077.1
GPx1 GTAGCATCGCTCTGAGGCAC
TTGGCATTTTCCTGATGCCC
131 XM_005695962.1
GPx3 TTCGGTCTGGTCATTCTGGG
CGAACATACTTGAGGGTGGC
95 XM_005683183.1
HMOX2 AGCTAGACAAAGGTGCCCTG
CAGGATGCTGACAGGCAAAG
113 XM_005697930.1
MGST3 AGCTCACCAGAACACGTTGG
GCCCAAACCAGAAGCTATGC
94 NM_001285615.1
NQO1 CATGGCTGTCAGAAAAGCACTG
GACACAGTGACCTCCCATCC
120 XM_005692193.1
UGT1A1 TCCGGAGCAGAAAGCTATGG
CCGAGTCTTTGGGTGACCAAG
160 XM_005678746.1
TXNRD1 TTTCGCTCAGTTTGCTCCAG
TCCTGAGAAGCCTTCAGGGTC
200 XM_005680564.1
NF-kB AGGTGGCGATCGTTGTTCTA
TTGCCTTTGTTCTTCCTGCC
226 XM_00569893.1
NrF2 AGCCAGGTGAGATGGAACTG
CCAGACTCCCTGTTTCGCTG
120 XM_005679848.2
MT2A TCCTGCAAGAAGAGCTGCTG
AACTGCACTTGTCCGAGGC
94 XM_005691999.1
SRXN1 GACACGATCCGGGAGAATCC
GGTCTGAGAGGGTGGATTGG
175 XM_013968785.1
MT1A ATAATAGCGCTCGGCTCCTG
TTGGAGGAAAAGCGAGGTCC
98 XM_005692001.2
GAPDH CCTGCCCGTTCGACAGATAG
CCGTTCTCTGCCTTGACTGT
249 XM_005680968.2
  1. aSOD1 superoxide dismutase 1, SOD2 superoxide dismutase 2, SOD3 superoxide dismutase3, GPX1 glutathione peroxidase1, GPX3 glutathione peroxidase 3, CAT catalase, HMOX2 haem oxygenase 2, MGST3 microsomal glutathione S-transferase 3, MT1A metallothionein 1A, NQO1 NAD(P)H, quinone 1, UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1, MT2A metallothionein 2A, TXNRD1 thioredoxin reductase 1, SRXN1 sulfiredoxin 1, GAPDH glyceraldehyde 3-phosphate dehydrogenase
  2. bThe first primer listed for each gene is the forward primer, and the second primer is the reverse primer
  3. cThe reference sequence numbers are given for primers whose source is the National Center for Biotechnology Information (NCBI) GenBank database (http://www.ncbi.nlm.nih.gov/genbank/)