Skip to main content

Advertisement

Table 2 Primer sequences used for real-time PCR amplification of selected genes in the livers of lactating goats

From: Sodium butyrate improves antioxidant stability in sub-acute ruminal acidosis in dairy goats

Genea Primers 5′ to 3’b Size(bp) Accession c
SOD1 ACACAAGGCTGTACCAGTGC TTCACATTGCCCAGGTCTCC 104 NM_001285550.1
SOD2 TCAATAAGGAGCAGGGACGC AGCAGGGGGATAAGACCTGT 85 XM_005684984.1
SOD3 ATCGACCCGAACGGTAACGC AGGACATAGAAGGGGTCTGCG 199 XM_005681678.1
CAT ACAATGTCACTCAGGTGCGG TCTCACACAGGCGTTTCCTC 70 XM_005690077.1
GPx1 GTAGCATCGCTCTGAGGCAC TTGGCATTTTCCTGATGCCC 131 XM_005695962.1
GPx3 TTCGGTCTGGTCATTCTGGG CGAACATACTTGAGGGTGGC 95 XM_005683183.1
HMOX2 AGCTAGACAAAGGTGCCCTG CAGGATGCTGACAGGCAAAG 113 XM_005697930.1
MGST3 AGCTCACCAGAACACGTTGG GCCCAAACCAGAAGCTATGC 94 NM_001285615.1
NQO1 CATGGCTGTCAGAAAAGCACTG GACACAGTGACCTCCCATCC 120 XM_005692193.1
UGT1A1 TCCGGAGCAGAAAGCTATGG CCGAGTCTTTGGGTGACCAAG 160 XM_005678746.1
TXNRD1 TTTCGCTCAGTTTGCTCCAG TCCTGAGAAGCCTTCAGGGTC 200 XM_005680564.1
NF-kB AGGTGGCGATCGTTGTTCTA TTGCCTTTGTTCTTCCTGCC 226 XM_00569893.1
NrF2 AGCCAGGTGAGATGGAACTG CCAGACTCCCTGTTTCGCTG 120 XM_005679848.2
MT2A TCCTGCAAGAAGAGCTGCTG AACTGCACTTGTCCGAGGC 94 XM_005691999.1
SRXN1 GACACGATCCGGGAGAATCC GGTCTGAGAGGGTGGATTGG 175 XM_013968785.1
MT1A ATAATAGCGCTCGGCTCCTG TTGGAGGAAAAGCGAGGTCC 98 XM_005692001.2
GAPDH CCTGCCCGTTCGACAGATAG CCGTTCTCTGCCTTGACTGT 249 XM_005680968.2
  1. aSOD1 superoxide dismutase 1, SOD2 superoxide dismutase 2, SOD3 superoxide dismutase3, GPX1 glutathione peroxidase1, GPX3 glutathione peroxidase 3, CAT catalase, HMOX2 haem oxygenase 2, MGST3 microsomal glutathione S-transferase 3, MT1A metallothionein 1A, NQO1 NAD(P)H, quinone 1, UGT1A1 UDP glucuronosyltransferase 1 family, polypeptide A1, MT2A metallothionein 2A, TXNRD1 thioredoxin reductase 1, SRXN1 sulfiredoxin 1, GAPDH glyceraldehyde 3-phosphate dehydrogenase
  2. bThe first primer listed for each gene is the forward primer, and the second primer is the reverse primer
  3. cThe reference sequence numbers are given for primers whose source is the National Center for Biotechnology Information (NCBI) GenBank database (http://www.ncbi.nlm.nih.gov/genbank/)