Skip to main content

Table 3 Primers used for qRT-PCR

From: Effects of vitamin E, inorganic selenium, bacterial organic selenium, and their combinations on immunity response in broiler chickens

Gene size (bp) Sequence (5′_3′) References
IL-2 144 F- GTGGCTAACTAATCTGCTGTCCA
R- CCGTAGGGCTTACAGAAAGG
[45]
IL-10 172 F- TAACATCCAACTGCTCAGCTC
R- TGATGACTGGTGCTGGTCTG
[45]
IFN- γ 214 F- GAGCCATCACCAAGAAGATGA
R- TAGGTCCACCGTCAGCTACA
[45]
TNF-α F- GCTGTTCTATGACCGCCCAGTT
R- AACAACCAGCTATGCACCCCA
[46]
GAPDH 312 F- CTGGCAAAGTCCAAGTGGTG
R- AGCACCACCCTTCAGATGAG
[45]