Skip to main content

Table 3 Target gene information and primers used for Pasteurella multocida type A identification and detection of virulence factors

From: Pathogenic variability among Pasteurella multocida type A isolates from Brazilian pig farms

Gene Function Location Gene N°. Acc. Primers DNA-sequences of oligonucleotide primers (5′ – 3′) Product Size (bp) Reference
KMT1 Species-specific 213–232 AF016259 KMT1 F ATCCGCTATTTACCCAGTGG 460 Townsend et al. (2001) [15]
669–649 KMT1 R GCTGTAAACGAACTCGCCAC
hyaD-hyaC Capsular synthesis 8846–8863 AF067175 CAPA F TGCCAAAATCGCAGTCAG 1.044
9890–9873 CAPA R TTGCCATCATTGTCAGTG
dcbF Capsular synthesis 3142–3165 AF302465. CAPD F TTACAAAAGAAAGACTAGGAGCCC 657
3789–3766 CAPD R CATCTACCCACTCAACCATATCAG
fcbD Capsular synthesis 2881–2896 AF302467 CAPF F AATCGGAGAACGCAGAAATCAG 851
3733–3714 CAPF R TTCCGCCGTCAATTACTCTG
pfhA Adherence 2409–2427 AY035342 PfhA F AGCTGATCAAGTGGTGAAC 275 Ewers et al. (2006) [10]
2684–2665 PfhA R TGGTACATTGGTGAATGGTG
tbpA Iron acquisition 68–85 Pm0337 TbPA F TTTG GTT GGA AAC GGT AAA GC 728 Ewers et al. (2006) [10]
Modified by Atashpaz et al. (2009) [11]
487–470 TbPA R TAA CGT GTA CGG AAA AGC CCC
hgbB Iron acquisition 308–328 Pm0337 HgbB F TCA TTG AGT ACG GCT TGA C 499 Atashpaz et al. (2009) [11]
1096–1077 HgbB R CTT ACG TCA GTA ACA CTC G
toxA Toxin 1878–1897 AF240778 ToxA F TTCT TAG ATG AGC GAC AAG G 846 Lichtensteiger et al. (1996) [46] modified by Atashpaz et al. (2009) [11]
2743–2725 ToxA R GAA TGC CAC ACC TCT ATA G