Skip to main content

Table 1 Primers for PCR of the complete genome of PRRSV GSWW/2015 strain

From: The molecular characteristic analysis of PRRSV GSWW/2015 strain and its pathogenicity to pigs

Fragment Sequence of primers(5′-3′) Position in genome
A ATGACGTATAGGTGTTGGCTCTATG 1–1518
GGAAATGCAGTGCCAACCACARTTC
B ACTTCTCYGTTAAGGAGAGTTGGAT 1175–4216
GATACAGTCTGCAACAATGCCAAGCCTAAGCA
C GTTACAGTTACCCATTCTTCGG 3911–5191
GAGGTACCCAAACATAACTAGC
D CCTTGGTCGTTTTGATTTTTGT 5081–6304
AAGATAGCACAAACATCCCAAAG
E GGCAGTCACATAATTAAAGACACAT 6061–7292
TGGACCTCCTCATAAAACACAT
F ATTCCGGTGATGTGTTTTATGAGGAGGT 7262–10,030
ACATCACCATCCTGGACYTGTTGAAG
G TTACCACACCCACTTCCACCAGCATTG 9604–12,066
AGAGGCTTTGCATAGACCCCATTTCATTTCAATTCA
H TGAATTGAAATGAAATGGGGTCTATGCAAAGCCTCT 11,973–14,584
CGGCATCTGGAGGTGATGAATTTCCAGGTTTCTAT
I CCTTCGGGTACATGACATTCGT 14,543–15,347
TTTTTTTTTTTTTTTTTTTTTTTTTTTAATTWCGG