Skip to main content

Table 2 Primer sequences for real-time PCR analysis

From: Effects of low-molecular-weight chitosan on the growth performance, intestinal morphology, barrier function, cytokine expression and antioxidant system of weaned piglets

Gene Sequence(5′ → 3′) Product size (bp) GenBank accession
number
ZO-1 CTCTTGGCTTGCTATTCG 256 XM_003353439.2
AGTCTTCCCTGCTCTTGC
Occludin GTAGTCGGGTTCGTTTCC 167 NM_001163647.2
GACCTGATTGCCTAGAGTGT
IL-1β CTCCAGCCAGTCTTCATTGTTC 132 NM_214055.1
TGCCTGATGCTCTTGTTCCA
TNF-α CACCACGCTCTTCTGCCTAC 116 X54859
ACGGGCTTATCTGAGGTTTGAGACG
IL-10 GGTTGCCAAGCCTTGTCAG 202 NM_214041
AGGCACTCTTCACCTCCTC
TGF-β GAAGCGCATCGAGGCCATTC 162 NM_214015
GGCTCCGGTTCGACACTTTC
β-actin CGGGACATCAAGGAGAAGC 273 DQ845171
ACAGCACCGTGTTGGCGTAGAG