Skip to main content

Table 2 Primers used in this study

From: Construction and characterization of thymidine auxotrophic (ΔthyA) recombinant Lactobacillus casei expressing bovine lactoferricin

Primer Primer sequence (5′-3′) Product size
Cloning primers
 rrnBT1T2 F:ACTAGTGTCAATGATGAGATCTGGCTGTTTTGGCGGATGAGAGA
R:CTCGAGAGAGTTTGTAGAAACGCAAAAAGGC
438 bp
 LFEC F:TCTAGAGATCTCTCCTTCACAGATTCCCAAT
R:CTCGAGAGAGTTTGTAGAAACGCAAAAAGGC
1022 bp
 TF F: GGCGCGCCTTAGGCGAGACCGTTCAT
R:TTAATTAACGTATGACGCACTAGTCGATCAGGCTTGAAATGG
1020 bp
 TR F:ACTAGTGACTAGCGATCTCGAGCACGCATACAGGCACGTA
R: TTAATTAAGGGTCACGAGCAAGGTAT
1392 bp
Screening primers
thyA F: TGTGGCATCACTTAGGACC
R: TGTGGCATCACTTAGGACC
3268 bp
Real-time PCR primes
 PEDV-N F:ACTGAGGGTGTTTTCTGGGTTGC
R:GGTTCAACAATCTCAACTACACTGG
137 bp
 Beta-actin F:AAGGATTCATATGTGGGCGATG
R:TCTCCATGTCGTCCCAGTTGGT
103 bp
  1. Enzyme restriction sites are underlined