Skip to main content

Table 1 List of primers used for real time PCR

From: Expression kinetics of natural resistance associated macrophage protein (NRAMP) genes in Salmonella Typhimurium-infected chicken

Target Primer sequence (5′ → 3′) Size of Amplicon Tm °C Reference
β Actin Forward primer TGGCATTGCTGACAGGAT 160 bp 63.1 [24]
Reverse primer CTGCTTGCTGATCCACAT 60.0
NRAMP1 Forward primer CCCCCACATCACCCCGTCC 180 bp 74.2 [24]
Reverse primer GGCCCCACACTGCAGGTCTGAC 74.4
NRAMP2 Forward primer GTACTCAGGGCAGTTCGTCA 162 bp 63.0 This study
Reverse primer GCACGTTGAGGAAGTCGTTC 64.8