Skip to main content

Table 1 Primers used in experiment

From: Selenium ameliorates Staphylococcus aureus-induced inflammation in bovine mammary epithelial cells by inhibiting activation of TLR2, NF-κB and MAPK signaling pathways

Gene Sequence
β-actin F:ACATCCGCAAGGACCTCTA
R:CCATGCCAATCTCATCTCGTT
TNF-α F:CTGCTGACGGGCTTTACC
R:GACTGCAATGCGGCTGAT
IL-1β F:GCTATGAGCCACTTCGTGAGGAC
R:GATTGAGGGCGTCGTTCAGGAT
IL-6 F:TGATGACTTCTGCTTTCCCTACCC
R:ATCTTTGCGTTCTTTACCCACTCG
TLR2 F:GATGACTACCGCTGTGAC
R:GGTTTTGTGGCTCTTTTC
Myd88 F:AGCAGCATAACTCGGATAA
R:CAGACACGCACAACTTCA
Irak4 F:TGGCAAAGACAGGACATCTG
R:CACAACTCCCAAACCCTCCTT
Irak1 F:GAGTTCCAACGTCCTTCTGG
R:CTCCCGGTCTTCACGTACTG
Traf6 F:CGGTGACTCTCTCCAGGTGT
R:TGGACATTTGTGACCTGCAT