Skip to main content

Table 1 Primers used for the amplification of the full-length CSFV

From: Complete genomic characteristics and pathogenic analysis of the newly emerged classical swine fever virus in China

Fragment Primer sequence (5′-3′) a Position in genomea Product size (bp)a
CSFV-A GTATACGAGGTTAGTTCATTCTCGT
GATTACCAGAGAAAGCAACAAGAAT
1-2047 2047
CSFV-B GATAATAGGCCCCGGTAAATTTGAC
TTTCCTTACAGGTCCCTCGCTAGAG
2023–3313 1291
CSFV-C AAATGAGACGGGTTACAGGGTA
CATCCCGTAGATCTCTTCACCTCCA
3124–4771 1648
CSFV-D CATAGATGAAATAGCTGGCGGGACC
TAGTGCTCTGCCAGCCTCCACAGTG
4564–7171 2608
CSFV-E TCTGCTGATATCAGAGGAGCTG
GCTTACCCAGACTTAATGTTTCTAG
6866–9668 2803
CSFV-F GCCCTATGTAAGGTCGACACCGCTC
GGGCCGTTAGGAAATTACCTTAGTC
9572–12,296 2725
  1. aThe sequence of primer sequence, position in genome and product size with respect to the CSFV Zj0801 (accession no. FJ529205) genome