Skip to main content

Table 1 Primer sequences, product sizes, and annealing temperatures of bovine genes analyzed by RT-PCR

From: Distinct correlations between lipogenic gene expression and fatty acid composition of subcutaneous fat among cattle breeds

Gene symbol
[GenBank accession]
Primer sequence (5′ - 3′) Product (bp) Annealing temperature
SCD1 P: CCTCTGGAACATCACCAGCTTCTCGGC 106 60
[NM_173959] F: GCTGTCAAAGAAAAGGGTTCCAC   
  R: AGCACAACAACAGGACACCAG   
SCD5 P: CAGAACCCGCTCGTCACCCTGGG 82 60
[NM_001076945] F: CCCTATGACAAGCACATCAGCC   
  R: GATGGTAGTTATGGAAACCTTCACC   
SREBP1 P: CAGCCCCAGTCCTGGATCAGCCGA 83 60
[NM_001113302] F: CTTGGAGCGAGCACTGAATTG   
  R: GGGCATCTGAGAACTCCTTGTC   
  1. P = probe, F forward, R reverse