Skip to main content

Table 2 The differences (D) or similarities (S) between the known viral miRNAs from CHv and VAc strain (miRBase)

From: Virulent duck enteritis virus infected DEF cells generate a unique pattern of viral microRNAs and a novel set of host microRNAs

Name CHv-Seq(5′-3′) Vac-Seq(5′-3′) Seq(S/D) Seed Seq(S/D)a
dev-miR-D1-3p UCCUCUUGCGCGAUCCCCACGU UCCUCUUGCGCGAUCCCCACGU S S
dev-miR-D1-5p UUGGGAAUGGCGGAAGAGCAGACU UUGGGAAUGGCGGAAGAGCAGACU S S
dev-miR-D3-3p AUUGUUGCGUUUGGUGGUUUGUG AUUGUUGCGUUUGGUGGUUUGUG S S
dev-miR-D4-3p UUGUCGGAUUGGUAUGCUUU UUAAUUGUCGGAUUGGUAUGCUUUUU D D
dev-miR-D5-5p UGUCAUCUGCGACGUCCUGCUCG UGUCAUCUGCGACGUCCUGCUCG S S
dev-miR-D6-3p GUCAGAGUGUCGGUGAGUCGA GUCAGAGUGUCGGUGAGUCGACG D S
dev-miR-D6-5p UGACACACCACCAUUCUGGCCG UGACACACCACCAUUCUGGCCG S S
dev-miR-D7-5p CGUAGCGGCGUAUAAUGGUUU UUCGUAGCGGCGUAUAAUGGUUU D D
dev-miR-D8-3p UACAGUUUCGUUGGGCGGUUU UACAGUUUCGUUGGGCGGUUUC D S
dev-miR-D8-5p UGCCUCCCGAUUAAACUAUACG UGCCUCCCGAUUAAACUAUACGC D S
dev-miR-D9-3p CAGUCCAGAAUGUUCAAAC CAGUCCAGAAUGUUCAAACG D S
dev-miR-D9-5p CGUUUGAACGUUCUGUACUGCC CGUUUGAACGUUCUGUACUGCCC D S
dev-miR-D11-3p AAAAGGGCAGCCUGGGCU GCAAAAGGGCAGCCUGGGCUCUAU D D
dev-miR-D12–3p CUCCGCGGUGAGGUCCCAGAA CUCCGCGGUGAGGUCCCAGAAA D S
dev-miR-D12–5p UACCUGGGACAGAACCGCGGCCG UACCUGGGACAGAACCGCGGCCG S S
dev-miR-D13-5p CGUGGGGUAGAACGCAUG CCCGUGGGGUAGAACGCAU D D
dev-miR-D14-3p GUUAUGUCUGGUUAUUAUGUUUU GCGUUAUGUCUGGUUAUUAUGUUUUU D D
dev-miR-D15-3p CGAGCGUGGGCAAGGUACC CGAGCGUGGGCAAGGUACCAG D S
dev-miR-D16-3p CUAAACACCAACGGAUGAACGU CUAAACACCAACGGAUGAACGU S S
dev-miR-D17-3p UCCGACCGCUCGCCUUCGAGGC GACCGCUCGCCUUCGAGGCCACC D D
dev-miR-D17-5p UGCAACGAAGGCGAACGGUUGA UGCAACGAAGGCGAACGGUUG D S
dev-miR-D18-3p CCAUCCCCUCCGCUGGCCCCAA CCAUCCCCUCCGCUGGCCCCAA S S
dev-miR-D18-5p GGGAUCGGUGAGGGGGGAUUGUG GGGAUCGGUGAGGGGGGAUUGUG S S
dev-miR-D19-5p AUGAAAGAGCGGUGCCUUU GAUGAAAGAGCGGUGCCUUU D D
dev-miR-D20-5p AAUGUCGGCCAGCCUCUCCGCUU AAUGUCGGCCAGCCUCUCCGCUU S S
dev-miR-D21-3p AUCCAUGCAAUCUCCAAACAAC AUCCAUGCAAUCUCCAAACAACC D S
dev-miR-D21-5p GGUUUGGAGACAGCUGCGGUGG UGGUUUGGAGACAGCUGCGGUGGU D D
dev-miR-D22–3p GUCACACAAGGCGGCUAGCAGG GUCACACAAGGCGGCUAGCAGG S S
dev-miR-D22-5p UUACCCGCCCAUGCGUGACUGCC UUACCCGCCCAUGCGUGACUGCC S S
dev-miR-D23-3p CGAACCGUCACAGUCUGCAGA CGCGAACCGUCACAGUCUGCAG D D
dev-miR-D24-3p AUUGGCUUCAGAGUGCGAACGC AUUGGCUUCAGAGUGCGAACGC S S
dev-miR-D2–3pb   AUAAGGCGAUCCGUGGUUU   
dev-miR-D10-3pb   CUUUGAGUUCUAGCCCGUCUAUC   
  1. aSeed sequence of miRNAs were present in italic font
  2. bThe dev-miR-D2–3p and dev-miR-D10-3p were not detected in CHv-infected DEF cells