Skip to main content

Table 1 Summary of sequence and genomic position of CHv-encoded miRNAs

From: Virulent duck enteritis virus infected DEF cells generate a unique pattern of viral microRNAs and a novel set of host microRNAs

Name Sequence(5′-3′) Length Reads Position and Strand
dev-miR-D1-5p UUGGGAAUGGCGGAAGAGCAGACU 24 628 1328:1351 (−)
dev-miR-D1-3p UCCUCUUGCGCGAUCCCCACGU 22 479 1294:1315 (−)
dev-miR-D3-3p AUUGUUGCGUUUGGUGGUUUGUG 23 63 17,761:17783 (+)
dev-miR-D4-3p UUGUCGGAUUGGUAUGCUUU 20 4 25,758:25777 (−)
dev-miR-D5-5p UGUCAUCUGCGACGUCCUGCUCG 23 4157 52,654:52676 (−)
dev-miR-D6-5p UGACACACCACCAUUCUGGCCG 22 904 53,728:53749 (−)
dev-miR-D6-3p GUCAGAGUGUCGGUGAGUCGA 21 1018 53,695:53715 (−)
dev-miR-D7-5p CGUAGCGGCGUAUAAUGGUUU 21 20 68,655:68675 (+)
dev-miR-D8-5p UGCCUCCCGAUUAAACUAUACG 22 12 72,347:72368 (−)
dev-miR-D8-3p UACAGUUUCGUUGGGCGGUUU 21 18,987 72,309:72329 (−)
dev-miR-D9-5p CGUUUGAACGUUCUGUACUGCC 22 12,713 72,498:72519 (−)
dev-miR-D9-3p CAGUCCAGAAUGUUCAAAC 19 1680 72,458:72476 (−)
dev-miR-D11-3p AAAAGGGCAGCCUGGGCU 18 1 75,095:75112 (+)
dev-miR-D12–5p UACCUGGGACAGAACCGCGGCCG 23 15,960 79,299:79321 (−)
dev-miR-D12–3p CUCCGCGGUGAGGUCCCAGAA 21 870 79,263:79283 (−)
dev-miR-D13-5p CGUGGGGUAGAACGCAUG 18 14 105,693:105710 (−)
dev-miR-D14-3p GUUAUGUCUGGUUAUUAUGUUUU 23 1 107,259:107281 (−)
dev-miR-D15-3p CGAGCGUGGGCAAGGUACC 19 700 112,570:112588 (−)
dev-miR-D16-3p CUAAACACCAACGGAUGAACGU 22 14,930 112,727:112748 (−)
dev-miR-D17-5p UGCAACGAAGGCGAACGGUUGA 22 5191 117,132:117153 (−)
dev-miR-D17-3p UCCGACCGCUCGCCUUCGAGGC 22 3 117,098:117119 (−)
dev-miR-D18-5p GGGAUCGGUGAGGGGGGAUUGUG 23 2676 119,157:119179 (−)
dev-miR-D18-3p CCAUCCCCUCCGCUGGCCCCAA 22 1819 119,119:119140 (−)
dev-miR-D19-5p AUGAAAGAGCGGUGCCUUU 19 771 119,180:119198 (−)
dev-miR-D20-5p AAUGUCGGCCAGCCUCUCCGCUU 23 11,422 125,008:125030 (+)/160,535:160557(−)
dev-miR-D21-5p GGUUUGGAGACAGCUGCGGUGG 22 651 125,178:125199 (+)/160,366:160387(−)
dev-miR-D21-3p AUCCAUGCAAUCUCCAAACAAC 22 347 125,218:125239 (+)/160,326:160347(−)
dev-miR-D22-5p UUACCCGCCCAUGCGUGACUGCC 23 2201 126,494:126516 (+)/159,049:159071(−)
dev-miR-D22–3p GUCACACAAGGCGGCUAGCAGG 22 11 126,532:126553 (+)/159,012:159033(−)
dev-miR-D23-3p CGAACCGUCACAGUCUGCAGA 21 3322 128,060:128080 (+)/157,485:157505(−)
dev-miR-D24-3p AUUGGCUUCAGAGUGCGAACGC 22 21 134,514:134535 (+)/151,030:151051(−)
dev-miR-D25-5p UGUGGGGACCGUGUAUGAGAUGU 23 145 696:718 (−)
dev-miR-D26-5p AUCGAAGCGAGGCGAGAUAACCU 23 12 26,368:26390 (−)
dev-miR-D26-3p GUUCUCCCUUGCUUUGACAU 20 12 26,329:26348 (−)
dev-miR-D27-5P AUCCUGGACCGAUAUAUGGACA 22 197 73,467:73488 (−)
dev-miR-D28-3P CUGGUGGGAAGAAUUUUCGC 20 149 77,133:77152 (−)
dev-miR-D29-5p AACAUAUCUCUUGACCUCUGGCGU 24 2323 87,039:87062 (−)
dev-miR-D30-3P ACUGGCUGGGGUGCAACUAAGU 22 9 103,962:103983 (−)
dev-miR-D31-3p AUCACGGGGUGUUAGAUGAACC 22 13,664 123,167:123188 (+)