Skip to main content

Table 1 Primers were designed to amplify the Full-length genome of PTV HuN-1

From: Molecular characterization of a porcine teschovirus HuN-1 isolate proliferating in PK-15 cell

Primers Nucleotide Sequences Position Length(nt)
P1-F 5′-CTCCCTTTGAATTTGTAA-3′ 1–18 382
P1-R 5′-GGCCAGCCGCGACCCTGTCAG-3′ 362–382
P2-F 5′-GGACTGGACTTGTGCTGCC-3′ 344–362 1328
P2-R 5′-ATRTCAACRCTRGGTGTTCCTCC-3′ 1648–1671
P3-F 5′-CCCTAGGACAAATTCMTCAGCAA-3′ 1522–1544 978
P3-R 5′-CCTGTTTCTGCAGGTTGMAGGGG-3′ 2477–2499
P4-F 5′-GGTCACGGGGATACATCACTA-3′ 2316–2336 988
P4-R 5′- AACAGGGAGAAGTTTGTAGCA −3′ 3262–3282
P5-F 5′-ATCTTATTCAAATGAATCTAC-3′ 3172–3192 797
P5-R 5′-YTCTGTCTGGRTGCCTGTAATT-3′ 3947–3968
P6-F 5′- CGGCTCAAAACCTGGAGAACT −3′ 3839–3859 789
P6-R 5′- TAGGGTATGTTTGCCATGTTTA −3 4606–4627
P7-F 5′-AAGCCTGACGGGACACTTGAT-3 4493–4513 1457
P7-R 5′-GGTTCAAGAAAGTCTGGTGGC-3 5929–5949
P8-F 5′- GCCAACATTTGTGTGTGGTGATC -3 5743–5765 1356
P8-R 5′-AACTAAAACTACTCAAGCAACAGGC-3 7074–7098
  1. Reference strains were used to design the primers are as follows: CH/IMH/03 (DQ355222); JF613 (GU446660); 10BJ02 (JQ975417); HB-2010 (JQ664746); Jilin/2003/2 (JN710381); NC_003985