Skip to main content

Table 1 Primer sequences for qPCR

From: Modulation of ovine SBD-1 expression by Saccharomyces cerevisiae in ovine ruminal epithelial cells

Gene names GenBank accession Fragment size (bp) Primer pair sequences (5`-3`)
SBD-1 U75250 206 F: GGCTCCATCACCTGCTCCTC
R: CGTCTTCGCCTTCTGTTACTTCTT
β-actin U39357 208 F: GTCACCAACTGGGACGACA
R: AGGCGTACAGGGACAGCA
TLR2 DQ890157.1 190 F: GTGTCCGCCGTGTGCTGTGC
R: AGTAGGAATCCCGCTCGCTGTAGG
MyD88 GQ221044.1 203 F: AGGTGCCGTCGGATGGTGGTGGTT
R: TGGTGGCAGGGGTTAGTGTAGTCA
NF-κB XM_012119628.1 95 F: CACCTTCTCCCAGCCCTTTG
R: TGCCACCTCCTCCTCCAG
p38 NM_001142894.1 74 F: CGTTCAGTTCCTTATCTACCAG
R: GCTCACAGTCTTCATTCACAG
JNK XM_004002020.3 113 F: ATGACTGCAAAGATGGAAACGA
R: ATGCTCTGCTTCAGAATCTTGG
ERK1/2 XM_012157699.1 90 F: GCGCTACACCAATCTCTCGT
R: ATGGCGACTCGGACTTTGTT