Skip to main content

Table 2 Primers used for amplification of MDV viral genes

From: First molecular detection and characterization of Marek’s disease virus in red-crowned cranes (Grus japonensis): a case report

Name Sequence Length
Meq-RT-F CTTTCTCTCGGGTCGACTTC 347 bp
Meq-RT-R GTAAGCAGTCCAAGGGTCAC  
gB-RT-F CTTCACAGTTGGGTGGGAC 338 bp
gB-RT-R GAGCCAGGGATTTGGATAG  
MDV-Meq-F AGAGATGTCTCAGGAGCCAGAGCC 1020 bp
MDV-Meq-R ATCATCAGGGTCTCCCGTCACCTG  
MDV-VP22-F ATCGGATCCATGGGGGATTCTGAAAG 750 bp
MDV-VP22-R ACACTCGAGTTATTCGCTATCACTGC