Skip to main content

Table 2 Primers used for quantitative PCR analysis

From: Influence of dietary protein and fructooligosaccharides on fecal fermentative end-products, fecal bacterial populations and apparent total tract digestibility in dogs

Target species Primer Sequence (5′-3′) Reference
Total bacteria FP 16S GGTAGTCYAYGCMSTAAACG [53]
RP 16S GACARCCATGCASCACCTG  
Escherichia coli E. coli F GTTAATACCTTTGCTCATTGA [54]
E. coli R ACCAGGGTATCTAATCC TGTT  
Bifidobacterium genus g-Bifid-F CTCCTGGAAACGGGTGG [55]
g-Bifid-R GGTGTTCTTCCCGATATCTACA  
Lactobacillus genus Lab-0159 GGAAACAG(A/G)TGCTAATACCG [56]
Univ-0515 ATCGTATTACCGCGGCTGCTGGCA  
Enterococcus genus EnteroF CCCTTATTGTTAGTTGCCATCATT [57]
EnteroR ACTCGTTGTACTTCCCATTGT  
Clostridium perfringens CP1 AAAGATGGCATCATCATTCAAC [58]
CP2 TACCGTCATTATCTTCCCCAAA