Skip to main content

Table 1 Oligonucleotides

From: Molecular iodine/doxorubicin neoadjuvant treatment impair invasive capacity and attenuate side effect in canine mammary cancer

Gen Reference Forward primer Reverse primer pb
β-actin 1 NM_001101 acagagtacttgcgctcagga ccatcatgaagtgtgacgttg 175
PGK12 NM_053291.3 tgactttggacaagctggacgtga cagcagccttgatcctttggttgt 110
Bax3 NM_001003011.1 aagctgagcgagtgtctcaagcgc tcccgccacaaagatggtcacg 366
Bcl24 NM_000633.2 gtggaggagctcttcaggga aggcacccagggtgatgcaa 304
PPARγ5 XM_005632014.1 ttccattctcaagagcggaccc tctccacagactcggcattcaa 190
Survivin6 NM_001003348.1 accgcgtctctacgttcaag ccaagtctggctcgttctca 114
uPA7 XM_005618862.1 ttggggagatgaagtttgaggtgg cagaacggatcttcagcaaggc 105
MDR18 NM_001003215.1 tatcagcagcccacgtcatc cagccactgctacctacgag 214
  1. 1, 3, 4 Human, 2 Rat, 5, 6, 7, 8 Canine