Skip to main content

Table 2 Primers used in this study

From: Molecular characterization of US-like and Asian non-S INDEL strains of porcine epidemic diarrhea virus (PEDV) that circulated in Japan during 2013–2016 and PEDVs collected from recurrent outbreaks

Primer Nucleotide sequence (5′-3′) Target gene (fragment size, bp) Positiona
FS-F TCCATTAGTGATGTTGTGTTAGG Full-length S gene (4371) 20,530–24,900
FS-R ACTACATTRAGCTCCAACTC   
fMF CTTGTCACCGGTTGTGTAATAG Full-length M gene (826) 25,567–26,392
fMR CTGACAGAAGCCATAAAGTTTCTG   
fNF ACTGGTTGGGCTTTCTATGTC Full-length N gene (1507) 26,263–27,769
fNR CTCAGTAATAACAGTGTAATGGCAC   
  1. aNumbers correspond to positions within the Colorado/USA/2013 genome