Skip to main content

Table 2 Primer sequences

From: Characterisation of feline renal cortical fibroblast cultures and their transcriptional response to transforming growth factor β1

Gene Primer sequence (forward primer first, 5′ to 3′) Amplicon size (bp) GC Content (%) Annealing temp Primer dilution
RPS7 a GTCCCAGAAGCCGCACTTTGAC
CTCTTGCCCACAATCTCGCTCG
82 59
59
60.8 1:10
GAPDH a AGTATGATTCCACCCACGGCA
GATCTCGCTCCTGGAAGATGGT
101 5255 64.1 1:10
COL1A1 GAGAGCATGACCGACGGATT
TAGGTGATGTTCTGGGACGC
122 55
55
58.7 1:10
TGFB1 b GGAATGGCTGTCCTTTGATG
TGCAGTGTGTTATCTTTGCTGTC
120 50
43.5
60 1:10
CTGF GGAAGACACATTTGGCCCAG
GCTTCTCCAACCTGCAGAAG
146 55
55
62.1 1:10
FN1 CCCTCACCAATCTCACTCCA
CCCTCGGAACATCAGAAACTG
117 55
52.4
58 1:10
  1. aPrimer obtained from previous publication: Penning et al. [56]
  2. bPrimer obtained from previous publication: Nguyen Van et al. [57]