Skip to main content

Table 1 The primer sequences used for real-time PCR

From: Cholesterol of lipid rafts is a key determinant for entry and post-entry control of porcine rotavirus infection

Gene Primer sequence (5′ to 3′)
VP7 Forward TGTCCTCTAAATACGCAGACTC
Reverse CTACCTGAATTACAGCGACAT
β-actin Forward GGCTCAGAGCAAGAGAGGTATCC
Reverse GGTCTCAAACATGATCTGAGTCATCT
VSV-G Forward TTCAAGCAGACGGTTGG
Reverse TGCTTCGGCATCCGTCA