Skip to main content

Table 1 RealAmp and PCR primers

From: Real-time fluorescence loop-mediated isothermal amplification assay for direct detection of egg drop syndrome virus

Method Primer name Length (bp) Sequence (5′-3′) Location of the primersa
RealAmp F3 20 AAAGGTTGCAGGGTATGTGT 24,070–24,089
B3 18 TAATGGCATTGGCCGCAA 24,297–24,314
FIP (F2) 20 GTTGGTGGGCTTGTACATGG 24,101–24,120
FIP (F1c) 22 TTCCCCCCGTAAACCAATACCC 24,146–24,167
BIP (B2) 20 TCACCACTCCACACTACTGG 24,257–24,276
BIP (B1c) 22 TGTCCTTTTAGTGCTCGCGACC 24,206–24,227
LF 25 CGCAGTAGCTTTAATCTGAATGGTC 24,121–24,145
LB 20 CCACTGCTAACCTGTCAGGC 24,228–24,247
PCR Fiber-F 20 ATGAAGCGACTACGGTTGGA 22,685–22,704
Fiber-R 26 CTACTGTGCTCCAACATATGTAAAGG 24,594–24,619
  1. F3- forward outer primer, B3- backward outer primer, LF- loop forward primer, LB- loop backward primer, FIP- forward inner primer and BIP- backward inner primer. F denotes forward primer and R denotes reverse primer, alocations of primers in EDSV genome