Skip to main content

Advertisement

Table 1 Primer sequences used for qRT-PCR amplification

From: Cortisol modulates inflammatory responses in LPS-stimulated RAW264.7 cells via the NF-κB and MAPK pathways

Gene Forward primer Reverse primer Accession number Product size(bp)
β-actin TGCTGTCCCTGTATGCCTCT TTTGATGTCACGCACGATTT NM_031144.3 224
IL-1β ACCTGTGTCTTTCCCGTGG TCATCTCGGAGCCTGTAGTG NM_031512.2 159
TNFα GCCTCCCTCTCATCAGTTCTA GGCAGCCTTGTCCCTTG NM_012675.3 246
IL-6 AGTTGTGCAATGGCAATTCTGA AGGACTCTGGCTTTGTCTTTCT NM_012589.2 223
iNOS TTCCAGAATCCCTGGACAAG TGGTCAAACTCTTGGGGTTC NM_012611.3 180
COX-2 AGAAGGAAATGGCTGCAGAA GCTCGGCTTCCAGTATTGAG NM_017232.3 194