Skip to main content

Table 2 Targets, primers and probes used for the MGB PCR assay with the associated working concentrations

From: A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M

Target (positon) Gene description Working concentration (nM)
Probe Primer
NL70_10085 (228) molecular chaperone DnaK VAC: CCGTCGTTATGACGAT (160) F: CCGGAAGGCACCCTTTTT (600)
NON: CCGTCGCTATGACGA (400) R: GATCCTTGTCCTTGGTGACCAT (600)
  1. The position of the SNP within each target is shown in parentheses. The target SNP is shown in bold underlined font in both vaccine (VAC) and nonspecific (NON) probes